rfhi4025b_f2.y1
| Sequence: | Distiller database | More info | 
| Sequence: | Distiller database | Help | Less info | 
| GAAATCAGATGTCCTGTGGTCAGAATCCAGGCTTCCCGGTCAATAAGGATGTCACGCTAA CAAGCCCATTGTTGGTCAACTTATTGCAGAGTGATATCTCTGCAGGCCATTTTGGGGTAA ACAATAAGCAAAATAACACCAACGCAAATAAACCGAAGAAGAAGAAACCCCCTCGGAAGA AGAAAAATAGTCAGCAAGATCTAAAGTAGGTTGTGATA | 
| Sequence: | Distiller database | Help | Less info | 
Blue-coloured subsequences are predicted RNA structures by RNAz
| GAAATCAGATGTCCTGTGGTCAGAATCCAGGCTTCCCGGTCAATAAGGATGTCACGCTAA CAAGCCCATTGTTGGTCAACTTATTGCAGAGTGATATCTCTGCAGGCCATTTTGGGGTAA ACAATAAGCAAAATAACACCAACGCAAATAAACCGAAGAAGAAGAAACCCCCTCGGAAGA AGAAAAATAGTCAGCAAGATCTAAAGTAGGTTGTGATA | 
| Predicted RNA structure(s): 1 entry(ies) | More info | 
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info | 
| 80-199, - strand, RNAz p=0.736319 | 
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info | 
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 80-199, - strand, RNAz p=0.736319 | 
| Aligned organism(s): 3 entry(ies) | More info | 
| Aligned organism(s): 3 entry(ies) | Help | Less info | 
| 1-218, gnl|bosTau2|chr13 (46806860-46807077) | |
| 1-218, gnl|Hg17|chr20 (32801071-32800854) | |
| 1-218, gnl|Mm7|chr2 (155155874-155155657) | 
| Aligned organism(s): 3 entry(ies) | Help | Less info | 
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-218, gnl|bosTau2|chr13 (46806860-46807077) | |
| 1-218, gnl|Hg17|chr20 (32801071-32800854) | |
| 1-218, gnl|Mm7|chr2 (155155874-155155657) | 
| Expressed library(ies): 1 entry(ies) | More info | 
| Expressed library(ies): 1 entry(ies) | Help | Less info | 
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| fhi (0.169578) | 
