rfhi4037b_j15.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| CCTTCTAGAAACAAATGTGTGTGGCAGCCCTGTTGGCCTTTTCTCCACAGGCTCTTGAAG GTCAAACCAGAGGAAAGACTTACCATCGAGGGAGTGTTGGACCAC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| CCTTCTAGAAACAAATGTGTGTGGCAGCCCTGTTGGCCTTTTCTCCACAGGCTCTTGAAG GTCAAACCAGAGGAAAGACTTACCATCGAGGGAGTGTTGGACCAC |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-105, gnl|bosTau2|chr17 (38765811-38765915) | |
| 1-105, gnl|Hg17|chr12 (110786390-110786494) | |
| 1-105, gnl|Mm7|chr5 (120763028-120762921) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-105, gnl|bosTau2|chr17 (38765811-38765915) | |
| 1-105, gnl|Hg17|chr12 (110786390-110786494) | |
| 1-105, gnl|Mm7|chr5 (120763028-120762921) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| fhi (0.169578) |