Non-Coding RNA Search

rfty521b_g18r1.y1

Sequence:


               
               GGGGGAAGAGAAGGGCTCGCCCGGAGCCACAGCTGGAAAGGAATTAACTCTCCAAAGGTC
TCCCCCTGCCCCCTCCCTAGTCAGACCTTCATGGTTTCTGCCCTGAGCCCTCCCAAGAGC
GGGCATC

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               GGGGGAAGAGAAGGGCTCGCCCGGAGCCACAGCTGGAAAGGAATTAACTCTCCAAAGGTC
TCCCCCTGCCCCCTCCCTAGTCAGACCTTCATGGTTTCTGCCCTGAGCCCTCCCAAGAGC
GGGCATC

Predicted RNA structure(s): 1 entry(ies)

More info

Predicted RNA structure(s): 1 entry(ies)

Help | Less info


               
               16-123, - strand, RNAz p=0.976326

Predicted RNA structure(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               16-123, - strand, RNAz p=0.976326

Aligned organism(s): 10 entry(ies)

More info

Aligned organism(s): 10 entry(ies)

Help | Less info


               
               3-126, gnl|bosTau2|chr2 (70395236-70395366)
               

               
               3-126, gnl|canFam2|chr26 (19293090-19293627)
               

               
               3-126, gnl|hg17|chr12 (119242414-119242948)
               

               
               3-126, gnl|Hg17|chr12 (119242752-119242609)
               

               
               3-126, gnl|mm7|chr5 (114675905-114675328)
               

               
               3-126, gnl|Mm7|chr5 (114675575-114675708)
               

               
               3-126, gnl|monDom2|scaffold_145 (2056827-2056249)
               

               
               3-126, gnl|panTro1|chr10 (122247067-122247601)
               

               
               3-126, gnl|rheMac2|chr11 (121348738-121349222)
               

               
               3-126, gnl|rn3|chr12 (42285559-42286117)

Aligned organism(s): 10 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               3-126, gnl|bosTau2|chr2 (70395236-70395366)
               

               
               3-126, gnl|canFam2|chr26 (19293090-19293627)
               

               
               3-126, gnl|hg17|chr12 (119242414-119242948)
               

               
               3-126, gnl|Hg17|chr12 (119242752-119242609)
               

               
               3-126, gnl|mm7|chr5 (114675905-114675328)
               

               
               3-126, gnl|Mm7|chr5 (114675575-114675708)
               

               
               3-126, gnl|monDom2|scaffold_145 (2056827-2056249)
               

               
               3-126, gnl|panTro1|chr10 (122247067-122247601)
               

               
               3-126, gnl|rheMac2|chr11 (121348738-121349222)
               

               
               3-126, gnl|rn3|chr12 (42285559-42286117)

Expressed library(ies): 1 entry(ies)

More info

Expressed library(ies): 1 entry(ies)

Help | Less info


               
               fty (0.17584)

Expressed library(ies): 1 entry(ies)

Help | Less info

Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description


               
               fty (0.17584)

	3-126, gnl\|bosTau2\|chr2 (70395236-70395366)
	3-126, gnl\|canFam2\|chr26 (19293090-19293627)
	3-126, gnl\|hg17\|chr12 (119242414-119242948)
	3-126, gnl\|Hg17\|chr12 (119242752-119242609)
	3-126, gnl\|mm7\|chr5 (114675905-114675328)
	3-126, gnl\|Mm7\|chr5 (114675575-114675708)
	3-126, gnl\|monDom2\|scaffold_145 (2056827-2056249)
	3-126, gnl\|panTro1\|chr10 (122247067-122247601)
	3-126, gnl\|rheMac2\|chr11 (121348738-121349222)
	3-126, gnl\|rn3\|chr12 (42285559-42286117)