rhea25_n10.y1
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
AAAGATTGACTCTACATCTCTGATTCAGCTGCCCCGTGGAGACAGAGACATTAAAGAAGA ATTAAGAATGAAGACAAGTATATTGATCTCCCTCACCAATCTCCTCCAACCAATACCTCT TAATCACAGAACAAATTGGAGTCCTGGTAAACTACTTTAATGAGCATCCATTCTATTTTT CAGTTCACATGATTGGAAGGGAAGCTATCCCCCACCTCCCTACCTGCTTCCTCTTTGTGT TGGTGATTTCACTCTCTCACACCGCATCTATATTTCATTTTATGTATACATGCATATATA TATTTCCACA |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
AAAGATTGACTCTACATCTCTGATTCAGCTGCCCCGTGGAGACAGAGACATTAAAGAAGA ATTAAGAATGAAGACAAGTATATTGATCTCCCTCACCAATCTCCTCCAACCAATACCTCT TAATCACAGAACAAATTGGAGTCCTGGTAAACTACTTTAATGAGCATCCATTCTATTTTT CAGTTCACATGATTGGAAGGGAAGCTATCCCCCACCTCCCTACCTGCTTCCTCTTTGTGT TGGTGATTTCACTCTCTCACACCGCATCTATATTTCATTTTATGTATACATGCATATATA TATTTCCACA |
Predicted RNA structure(s): 1 entry(ies) | More info |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
39-304, - strand, RNAz p=0.956508 |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
39-304, - strand, RNAz p=0.956508 |
Predicted microRNA(s): 1 entry(ies) | More info |
Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
6-157, - strand, RNAmicro p=0.93905 |
Aligned organism(s): 3 entry(ies) | More info |
Aligned organism(s): 3 entry(ies) | Help | Less info |
1-304, gnl|bosTau2|chr11 (28307762-28307460) | |
1-304, gnl|Hg17|chr2 (59010744-59011091) | |
1-304, gnl|Mm7|chr11 (25693165-25692865) |
Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
1-304, gnl|bosTau2|chr11 (28307762-28307460) | |
1-304, gnl|Hg17|chr2 (59010744-59011091) | |
1-304, gnl|Mm7|chr11 (25693165-25692865) |
Expressed library(ies): 1 entry(ies) | More info |
Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
hea (0.204499) |