rhyp10c_e22.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| CAAGCAGCTGCAGCCGTGGCAGCCCAGCCGCAAGGTGGACATCATGGGCTACGACTTGCC CAGTGGCCGCGCCGGCCCGGCCACCGAGGCCTGCCTCAAGCTGGCCATGCCCGAGGTGCA GTA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| CAAGCAGCTGCAGCCGTGGCAGCCCAGCCGCAAGGTGGACATCATGGGCTACGACTTGCC CAGTGGCCGCGCCGGCCCGGCCACCGAGGCCTGCCTCAAGCTGGCCATGCCCGAGGTGCA GTA |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 5-123, - strand, RNAz p=0.889635 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 5-123, - strand, RNAz p=0.889635 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-123, gnl|bosTau2|chr29 (38866588-38866466) | |
| 1-123, gnl|Hg17|chr11 (65566800-65566678) | |
| 1-123, gnl|Mm7|chr19 (5202454-5202576) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-123, gnl|bosTau2|chr29 (38866588-38866466) | |
| 1-123, gnl|Hg17|chr11 (65566800-65566678) | |
| 1-123, gnl|Mm7|chr19 (5202454-5202576) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| hyp (0.142837) |