rhyp14c_l4.y1
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
CACAAATGTAATACAGTTTTATTGTGTTACCATTTGTGTTCTGTTTGCTTCTTTGTATGT TGCATTTAGTACAATCAGTGTTTAAACTTACTGTATATTTATGCTT |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
CACAAATGTAATACAGTTTTATTGTGTTACCATTTGTGTTCTGTTTGCTTCTTTGTATGT TGCATTTAGTACAATCAGTGTTTAAACTTACTGTATATTTATGCTT |
Predicted RNA structure(s): 1 entry(ies) | More info |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
1-106, + strand, RNAz p=0.989727 |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
1-106, + strand, RNAz p=0.989727 |
Homologous human UTR: 1 entry(ies) | More info |
Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
5' of AB044745, + |
Aligned organism(s): 3 entry(ies) | More info |
Aligned organism(s): 3 entry(ies) | Help | Less info |
1-106, gnl|bosTau2|chr5 (54527360-54527254) | |
1-106, gnl|Hg17|chr12 (16595108-16595002) | |
1-106, gnl|Mm7|chr6 (138410334-138410228) |
Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
1-106, gnl|bosTau2|chr5 (54527360-54527254) | |
1-106, gnl|Hg17|chr12 (16595108-16595002) | |
1-106, gnl|Mm7|chr6 (138410334-138410228) |
Expressed library(ies): 1 entry(ies) | More info |
Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
hyp (0.142837) |