Non-Coding RNA Search

rjca08c_j9.y1

Sequence:


               
               GCAGGTCCTAGTGGCCCCATTGGACCACCTGGAATTCCAGGCCCCAAAGGGGAACCAGGT
CTCCCAGGACCCCCTGGGTTCCCTGGAGTAGGGAAGCCCGGAGTAGCAGGACTTCATGGC
CCCCCAGGGAAGCCTGGTGCCCTTGGTCCCCAAGGCCAGCCAGGCCTTCCAGGGCCCCCA
GGCCCTCCA

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               GCAGGTCCTAGTGGCCCCATTGGACCACCTGGAATTCCAGGCCCCAAAGGGGAACCAGGT
CTCCCAGGACCCCCTGGGTTCCCTGGAGTAGGGAAGCCCGGAGTAGCAGGACTTCATGGC
CCCCCAGGGAAGCCTGGTGCCCTTGGTCCCCAAGGCCAGCCAGGCCTTCCAGGGCCCCCA
GGCCCTCCA

Predicted RNA structure(s): 1 entry(ies)

More info

Predicted RNA structure(s): 1 entry(ies)

Help | Less info


               
               2-188, - strand, RNAz p=0.993409

Predicted RNA structure(s): 1 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               2-188, - strand, RNAz p=0.993409

Similar Transcript(s): 6 entry(ies)

More info

Similar Transcript(s): 6 entry(ies)

Help | Less info


               
               7-188, 603043764F1 NIH_MGC_116 Homo sapiens cDNA clone IMAGE (gb|BI760895.1|), 
blast E-value=0, identity=92.31% 
               

               
               7-188, AGENCOURT_6498603 NIH_MGC_125 Homo sapiens cDNA clone IMAGE 
(gb|BM546231.1|), blast E-value=0, identity=93.41% 
               

               
               7-188, UI-HF-EL0-avm-k-01-0-UI.r1 NIH_MGC_212 Homo sapiens cDNA clone 
(gb|CF124979.1|), blast E-value=0, identity=93.41% 
               

               
               7-188, 17000424526322 GRN_EB Homo sapiens cDNA 5', mRNA sequence 
(gb|CN367646.1|), blast E-value=0, identity=93.41% 
               

               
               2-188, CT020018A20E07 Equine Articular Cartilage cDNA Library Equus 
(gb|CX597565.1|), blast E-value=0, identity=93.58% 
               

               
               10-188, nag36g09.y1 Rabbit eye minus lens and cornea. Unnormalized (nag) 
(gb|DN890717.1|), blast E-value=0, identity=91.06%

Similar Transcript(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               7-188, 603043764F1 NIH_MGC_116 Homo sapiens cDNA clone IMAGE (gb|BI760895.1|), 
blast E-value=0, identity=92.31% 
               

               
               7-188, AGENCOURT_6498603 NIH_MGC_125 Homo sapiens cDNA clone IMAGE 
(gb|BM546231.1|), blast E-value=0, identity=93.41% 
               

               
               7-188, UI-HF-EL0-avm-k-01-0-UI.r1 NIH_MGC_212 Homo sapiens cDNA clone 
(gb|CF124979.1|), blast E-value=0, identity=93.41% 
               

               
               7-188, 17000424526322 GRN_EB Homo sapiens cDNA 5', mRNA sequence 
(gb|CN367646.1|), blast E-value=0, identity=93.41% 
               

               
               2-188, CT020018A20E07 Equine Articular Cartilage cDNA Library Equus 
(gb|CX597565.1|), blast E-value=0, identity=93.58% 
               

               
               10-188, nag36g09.y1 Rabbit eye minus lens and cornea. Unnormalized (nag) 
(gb|DN890717.1|), blast E-value=0, identity=91.06%

Aligned organism(s): 3 entry(ies)

More info

Aligned organism(s): 3 entry(ies)

Help | Less info


               
               2-188, gnl|bosTau2|chr1 (23525779-23525965)
               

               
               2-188, gnl|Hg17|chr3 (100996943-100997129)
               

               
               2-188, gnl|Mm7|chr16 (57489086-57488900)

Aligned organism(s): 3 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               2-188, gnl|bosTau2|chr1 (23525779-23525965)
               

               
               2-188, gnl|Hg17|chr3 (100996943-100997129)
               

               
               2-188, gnl|Mm7|chr16 (57489086-57488900)

Expressed library(ies): 1 entry(ies)

More info

Expressed library(ies): 1 entry(ies)

Help | Less info


               
               jca (0.11396)

Expressed library(ies): 1 entry(ies)

Help | Less info

Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description


               
               jca (0.11396)

	7-188, 603043764F1 NIH_MGC_116 Homo sapiens cDNA clone IMAGE (gb\|BI760895.1\|), blast E-value=0, identity=92.31%
	7-188, AGENCOURT_6498603 NIH_MGC_125 Homo sapiens cDNA clone IMAGE (gb\|BM546231.1\|), blast E-value=0, identity=93.41%
	7-188, UI-HF-EL0-avm-k-01-0-UI.r1 NIH_MGC_212 Homo sapiens cDNA clone (gb\|CF124979.1\|), blast E-value=0, identity=93.41%
	7-188, 17000424526322 GRN_EB Homo sapiens cDNA 5', mRNA sequence (gb\|CN367646.1\|), blast E-value=0, identity=93.41%
	2-188, CT020018A20E07 Equine Articular Cartilage cDNA Library Equus (gb\|CX597565.1\|), blast E-value=0, identity=93.58%
	10-188, nag36g09.y1 Rabbit eye minus lens and cornea. Unnormalized (nag) (gb\|DN890717.1\|), blast E-value=0, identity=91.06%

	2-188, gnl\|bosTau2\|chr1 (23525779-23525965)
	2-188, gnl\|Hg17\|chr3 (100996943-100997129)
	2-188, gnl\|Mm7\|chr16 (57489086-57488900)