rjej06b_b7.y1
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
AACCTTAGCAGAACTTCACCTGCAGCGGGTGCTGTTTCCTTTGGGCTGCTTGTCGGAGGC TGAAGAGCTAGTGGTGGGTTCTGCAGCCTTCAGTGAGGAGCAGCGGCTGGAAGCACTT |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
AACCTTAGCAGAACTTCACCTGCAGCGGGTGCTGTTTCCTTTGGGCTGCTTGTCGGAGGC TGAAGAGCTAGTGGTGGGTTCTGCAGCCTTCAGTGAGGAGCAGCGGCTGGAAGCACTT |
Predicted RNA structure(s): 1 entry(ies) | More info |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
3-118, + strand, RNAz p=0.912762 |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
3-118, + strand, RNAz p=0.912762 |
Predicted microRNA(s): 1 entry(ies) | More info |
Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
45-104, + strand, RNAmicro p=0.926083 |
Aligned organism(s): 3 entry(ies) | More info |
Aligned organism(s): 3 entry(ies) | Help | Less info |
3-118, gnl|bosTau2|chr5 (67466416-67466301) | |
3-118, gnl|Hg17|chr22 (16940858-16940973) | |
3-118, gnl|Mm7|chr6 (121212661-121212776) |
Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
3-118, gnl|bosTau2|chr5 (67466416-67466301) | |
3-118, gnl|Hg17|chr22 (16940858-16940973) | |
3-118, gnl|Mm7|chr6 (121212661-121212776) |
Expressed library(ies): 1 entry(ies) | More info |
Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
jej (0.0989218) |