rmed09c_c21.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GGCACACCTATCCACTGTGGCAGTGTCTCTGGGTCCCTAAAGGATACCATTCCGGTCCCC AACCCTGATGGTGAAATGACATAGCTACCCCACACCTAAACTGAGGTCAGACCACCTAGG CTTCCACCTGGTGAGCCCCAGCAGGGCTGAGACCCCCAGGGCGGCAGCCTGTCTGCTGCT GAGTGATTCAGGAGAACGCGTGCACATGCACACGTGTTTGCCCCACACAGGTGACACGGG GCC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GGCACACCTATCCACTGTGGCAGTGTCTCTGGGTCCCTAAAGGATACCATTCCGGTCCCC AACCCTGATGGTGAAATGACATAGCTACCCCACACCTAAACTGAGGTCAGACCACCTAGG CTTCCACCTGGTGAGCCCCAGCAGGGCTGAGACCCCCAGGGCGGCAGCCTGTCTGCTGCT GAGTGATTCAGGAGAACGCGTGCACATGCACACGTGTTTGCCCCACACAGGTGACACGGG GCC |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 80-241, - strand, RNAz p=0.892755 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 80-241, - strand, RNAz p=0.892755 |
| Predicted microRNA(s): 1 entry(ies) | More info |
| Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 90-222, - strand, RNAmicro p=0.999787 |
| Aligned organism(s): 2 entry(ies) | More info |
| Aligned organism(s): 2 entry(ies) | Help | Less info |
| 3-241, gnl|bosTau2|chr15 (16871016-16871262) | |
| 3-241, gnl|Hg17|chr11 (118273599-118273359) |
| Aligned organism(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 3-241, gnl|bosTau2|chr15 (16871016-16871262) | |
| 3-241, gnl|Hg17|chr11 (118273599-118273359) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| med (0.116252) |