rmed09c_c4.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| CCGAGCCGCTGAGCTCCGCTGCTTTCCCCGCGGTAGCTGCTGCCACCGCCGTCCTTCTAG CAGCGCGGGCTGGTCGGACCGCCGAGGCAGTCCGCGCCCGGCTATGGGAAGCAGAGCGGC CACGGACATAGGCTGTGGCAAAGTTTCCCAGACGCGCGTATCAGGGCGCGCGGCTGCCGA CTACCCGTGACCGCTGCTAGAAAGGCTCGGAGATTTTCAATTTGGAAAAAAAAAAAAAAA AAAA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| CCGAGCCGCTGAGCTCCGCTGCTTTCCCCGCGGTAGCTGCTGCCACCGCCGTCCTTCTAG CAGCGCGGGCTGGTCGGACCGCCGAGGCAGTCCGCGCCCGGCTATGGGAAGCAGAGCGGC CACGGACATAGGCTGTGGCAAAGTTTCCCAGACGCGCGTATCAGGGCGCGCGGCTGCCGA CTACCCGTGACCGCTGCTAGAAAGGCTCGGAGATTTTCAATTTGGAAAAAAAAAAAAAAA AAAA |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 1-120, - strand, RNAz p=0.996442 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 1-120, - strand, RNAz p=0.996442 |
| Predicted microRNA(s): 1 entry(ies) | More info |
| Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 38-177, + strand, RNAmicro p=0.999786 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-233, gnl|bosTau2|chr15 (27619452-27619223) | |
| 1-233, gnl|Hg17|chr11 (11600175-11599945) | |
| 1-233, gnl|Mm7|chr7 (107695547-107695297) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-233, gnl|bosTau2|chr15 (27619452-27619223) | |
| 1-233, gnl|Hg17|chr11 (11600175-11599945) | |
| 1-233, gnl|Mm7|chr7 (107695547-107695297) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| med (0.116252) |