rnco1912b_j22.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| TCGCCCTTTCAGGTGCTGGTGAAGAACGATGCTCGCAGGACCCGCTCCTTCTCCTGGACC AAGTCGGTGGACCTGGTGCTGGGCACCAGCACTGTCAGCCTCCAGCAGCACCTGACCGTG CGCTGGAATGGCTCGCGCATCGCGCTGCCCTGCCAGGCGCCGCAGTTCCA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| TCGCCCTTTCAGGTGCTGGTGAAGAACGATGCTCGCAGGACCCGCTCCTTCTCCTGGACC AAGTCGGTGGACCTGGTGCTGGGCACCAGCACTGTCAGCCTCCAGCAGCACCTGACCGTG CGCTGGAATGGCTCGCGCATCGCGCTGCCCTGCCAGGCGCCGCAGTTCCA |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 1-119, - strand, RNAz p=0.54288 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 1-119, - strand, RNAz p=0.54288 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-170, gnl|bosTau2|chr4 (35453517-35453686) | |
| 1-170, gnl|Hg17|chr7 (33891825-33891994) | |
| 1-170, gnl|Mm7|chr9 (23278498-23278667) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-170, gnl|bosTau2|chr4 (35453517-35453686) | |
| 1-170, gnl|Hg17|chr7 (33891825-33891994) | |
| 1-170, gnl|Mm7|chr9 (23278498-23278667) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| nco (0.161734) |