rnep14c_a14.y1
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
GCCAATATAATATAGTTAATGAAAACAGCATTTTTAAAAAGCCGAAATATTGAAATGGTG TAATGTTGTACCATTTGCACTGTGAGCAAATGCTAATACAGTAAATATATTGTGTTTGCT GACAATCAGCCGGCCTATAAATCTCCTTATTTTATTTCTTGTTTTCATAGCATAAAGTTT TGGTTTGGCCCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
GCCAATATAATATAGTTAATGAAAACAGCATTTTTAAAAAGCCGAAATATTGAAATGGTG TAATGTTGTACCATTTGCACTGTGAGCAAATGCTAATACAGTAAATATATTGTGTTTGCT GACAATCAGCCGGCCTATAAATCTCCTTATTTTATTTCTTGTTTTCATAGCATAAAGTTT TGGTTTGGCCCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Predicted RNA structure(s): 1 entry(ies) | More info |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
1-159, + strand, RNAz p=0.942568 |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
1-159, + strand, RNAz p=0.942568 |
Homologous human UTR: 1 entry(ies) | More info |
Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
5' of NM_004430, + |
Aligned organism(s): 3 entry(ies) | More info |
Aligned organism(s): 3 entry(ies) | Help | Less info |
1-189, gnl|bosTau2|chr8 (30854273-30854460) | |
1-189, gnl|Hg17|chr8 (22601309-22601122) | |
1-189, gnl|Mm7|chr14 (64726910-64727092) |
Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
1-189, gnl|bosTau2|chr8 (30854273-30854460) | |
1-189, gnl|Hg17|chr8 (22601309-22601122) | |
1-189, gnl|Mm7|chr14 (64726910-64727092) |
Expressed library(ies): 1 entry(ies) | More info |
Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
nep (0.183925) |