rnje13c_l13.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GAACACTGAAGACTCCTCCGAAGAAGAAACTCCGATTACCAGACACTGGGTTATATAATA TGACAGATTCAGGGACTGGCAGCTGCAAAAACAGCAGCAAGCCTGTGTAGATTACTTGTT AGGAAAAtgtttgtatgtgtgtatgtgcgtgtgtgtgtgtatgtgtgtttgcgtgtgtgt atgtgCACAGGTGTGTATTTGTGTGTCTATATACACACATGTGGGAATTACAGA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GAACACTGAAGACTCCTCCGAAGAAGAAACTCCGATTACCAGACACTGGGTTATATAATA TGACAGATTCAGGGACTGGCAGCTGCAAAAACAGCAGCAAGCCTGTGTAGATTACTTGTT AGGAAAAtgtttgtatgtgtgtatgtgcgtgtgtgtgtgtatgtgtgtttgcgtgtgtgt atgtgCACAGGTGTGTATTTGTGTGTCTATATACACACATGTGGGAATTACAGA |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 1-119, - strand, RNAz p=0.796613 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 1-119, - strand, RNAz p=0.796613 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-234, gnl|bosTau2|chr6 (32374931-32375152) | |
| 1-234, gnl|Hg17|chr4 (17561721-17561500) | |
| 1-234, gnl|Mm7|chr5 (45055707-45055455) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-234, gnl|bosTau2|chr6 (32374931-32375152) | |
| 1-234, gnl|Hg17|chr4 (17561721-17561500) | |
| 1-234, gnl|Mm7|chr5 (45055707-45055455) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| nje (0.16592) |