rnje28c_b12.y1
|
CCTCACTCCCAGCAGCCAGTGCATTACTCGCTCCTCTGGGCTCCCACACCACTTTGTATA
TACCTCTTATTGTAGCACTTAGCACACAGTAGCTCCTTAGCTATGTGTTTATGTATGTTT
TCCCTCCAATAgactgtgagctcctcaaggacagggactgtgtgttagtcactgatgtat
ccccagcgcctagcacagtgcctggcacacagtaggtgctcaataaatgtttATGGAAAG
AAAAAAAAAAA
|
Blue-coloured subsequences are predicted RNA structures by RNAz
|
CCTCACTCCCAGCAGCCAGTGCATTACTCGCTCCTCTGGGCTCCCACACCACTTTGTATA
TACCTCTTATTGTAGCACTTAGCACACAGTAGCTCCTTAGCTATGTGTTTATGTATGTTT
TCCCTCCAATAgactgtgagctcctcaaggacagggactgtgtgttagtcactgatgtat
ccccagcgcctagcacagtgcctggcacacagtaggtgctcaataaatgtttATGGAAAG
AAAAAAAAAAA
|
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
|
125-234, CR851356 Normalized and Subtracted bovine endometrium tissues
(emb|CR851356.2|), blast E-value=0, identity=100% |
|
125-240, UI-R-CX0-bwx-g-01-0-UI.s1 UI-R-CX0 Rattus norvegicus cDNA clone
(gb|BI278855.1|), blast E-value=4e-32, identity=91.45% |
|
125-234, 1Duo19F06a Bos taurus Duodenum #1 library Bos taurus cDNA, mRNA
(gb|BM431535.1|), blast E-value=0, identity=100% |
|
125-234, LeukoN5_5_B11.b1_A027 Unstimulated peripheral blood leukocytes N5
(gb|CD535885.1|), blast E-value=0, identity=100% |
|
125-240, UI-R-BJ1-avf-f-05-0-UI.s10 UI-R-BJ1 Rattus norvegicus cDNA clone
(gb|CK844121.1|), blast E-value=4e-32, identity=91.45% |
|
125-234, LIB4004-029-Q1-K1-H1 LIB4004 Canis familiaris cDNA clone
(gb|DN402738.1|), blast E-value=0, identity=100% |
PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
|
125-234, CR851356 Normalized and Subtracted bovine endometrium tissues
(emb|CR851356.2|), blast E-value=0, identity=100% |
|
125-240, UI-R-CX0-bwx-g-01-0-UI.s1 UI-R-CX0 Rattus norvegicus cDNA clone
(gb|BI278855.1|), blast E-value=4e-32, identity=91.45% |
|
125-234, 1Duo19F06a Bos taurus Duodenum #1 library Bos taurus cDNA, mRNA
(gb|BM431535.1|), blast E-value=0, identity=100% |
|
125-234, LeukoN5_5_B11.b1_A027 Unstimulated peripheral blood leukocytes N5
(gb|CD535885.1|), blast E-value=0, identity=100% |
|
125-240, UI-R-BJ1-avf-f-05-0-UI.s10 UI-R-BJ1 Rattus norvegicus cDNA clone
(gb|CK844121.1|), blast E-value=4e-32, identity=91.45% |
|
125-234, LIB4004-029-Q1-K1-H1 LIB4004 Canis familiaris cDNA clone
(gb|DN402738.1|), blast E-value=0, identity=100% |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map