rnmm30c_l7.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GTCTCGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGAGATCAAGTTAAATGTCCAATTT ATTTTTATAACTTGAAACCAGAACAAACTTGTGTTTTGAACAAGCGTACAAATGAAATGG CAGACATGCTGAACTCAACATTGTGACATTAAGGGGAAAAAGAAGAGGCCCCAAATCTTG TACAGAGAATAAAAGGAACAATAAATATTTTACTAAGCCATATTGAAATGACCTCCTGTC ATCTCAACATTTTATCCATAATAATAAAAAAAAAAAAAAAAAAA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GTCTCGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGAGATCAAGTTAAATGTCCAATTT ATTTTTATAACTTGAAACCAGAACAAACTTGTGTTTTGAACAAGCGTACAAATGAAATGG CAGACATGCTGAACTCAACATTGTGACATTAAGGGGAAAAAGAAGAGGCCCCAAATCTTG TACAGAGAATAAAAGGAACAATAAATATTTTACTAAGCCATATTGAAATGACCTCCTGTC ATCTCAACATTTTATCCATAATAATAAAAAAAAAAAAAAAAAAA |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 149-272, - strand, RNAz p=0.938936 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 149-272, - strand, RNAz p=0.938936 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 5' of NM_022898, - |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 33-272, gnl|bosTau2|chr21 (43820374-43820613) | |
| 33-272, gnl|Hg17|chr14 (98705377-98705611) | |
| 33-272, gnl|Mm7|chr12 (105431845-105432073) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 33-272, gnl|bosTau2|chr21 (43820374-43820613) | |
| 33-272, gnl|Hg17|chr14 (98705377-98705611) | |
| 33-272, gnl|Mm7|chr12 (105431845-105432073) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| nmm (0.132802) |