rova010_m5.y1
| Sequence: | Distiller database | More info | 
| Sequence: | Distiller database | Help | Less info | 
| ATTGTGTCAAAGGAAATAAGAAAGAAGTTTTATCTGAGTCCCCCCTACAACTAAGATAAT TCCTTTTGACCATTTAAGCCATTATAAATGCTTGTCTTGGAAAAGTGGAGTCTGTTTAGA AGCATCAACAATTATAGACCAggagttcccgttgtggtgcagcggaaacgaatctgacta ggaaacatgaggttgtgagtttgatccctggcctcactcagtgggttaaggatctggcgt tgccgtgagctgtggtgtaggttgcagacgaggctcggatctggcattgctgtggctatg gtgtaggcctgtggctacagctccgatt | 
| Sequence: | Distiller database | Help | Less info | 
Blue-coloured subsequences are predicted RNA structures by RNAz
| ATTGTGTCAAAGGAAATAAGAAAGAAGTTTTATCTGAGTCCCCCCTACAACTAAGATAAT TCCTTTTGACCATTTAAGCCATTATAAATGCTTGTCTTGGAAAAGTGGAGTCTGTTTAGA AGCATCAACAATTATAGACCAggagttcccgttgtggtgcagcggaaacgaatctgacta ggaaacatgaggttgtgagtttgatccctggcctcactcagtgggttaaggatctggcgt tgccgtgagctgtggtgtaggttgcagacgaggctcggatctggcattgctgtggctatg gtgtaggcctgtggctacagctccgatt | 
| Aligned organism(s): 3 entry(ies) | More info | 
| Aligned organism(s): 3 entry(ies) | Help | Less info | 
| 3-147, gnl|bosTau2|chr18 (30316187-30316334) | |
| 3-147, gnl|Hg17|chr16 (68291737-68291903) | |
| 3-147, gnl|Mm7|chr8 (105975327-105975542) | 
| Aligned organism(s): 3 entry(ies) | Help | Less info | 
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 3-147, gnl|bosTau2|chr18 (30316187-30316334) | |
| 3-147, gnl|Hg17|chr16 (68291737-68291903) | |
| 3-147, gnl|Mm7|chr8 (105975327-105975542) | 
| Expressed library(ies): 1 entry(ies) | More info | 
| Expressed library(ies): 1 entry(ies) | Help | Less info | 
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| ova (0.129132) | 
