rpfco0113_j18.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| AGGAGAAAAAATAAACGGAAATCATCAAAATTTCATTTCACATTAACAGTCTGAAAATAA ACCAAAGGACATTACGTGTGCATGTGTGTATAAGTGCACACAGAAATATATATACATATG TAGACTATATACACGTGTGTATATATGTGTATATATCTTTATATGC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| AGGAGAAAAAATAAACGGAAATCATCAAAATTTCATTTCACATTAACAGTCTGAAAATAA ACCAAAGGACATTACGTGTGCATGTGTGTATAAGTGCACACAGAAATATATATACATATG TAGACTATATACACGTGTGTATATATGTGTATATATCTTTATATGC |
| Predicted RNA structure(s): 2 entry(ies) | More info |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
| 4-164, + strand, RNAz p=0.980907 | |
| 19-164, - strand, RNAz p=0.997232 |
| Predicted RNA structure(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 4-164, + strand, RNAz p=0.980907 | |
| 19-164, - strand, RNAz p=0.997232 |
| Similar Transcript(s): 12 entry(ies) | More info |
| Similar Transcript(s): 12 entry(ies) | Help | Less info |
| 7-104, 718607 MARC 6BOV Bos taurus cDNA 5', mRNA sequence (gb|CB459124.1|), blast E-value=1e-32, identity=93.88% | |
| 7-104, 959818 MARC 1BOV Bos taurus cDNA 3', mRNA sequence (gb|CK771518.1|), blast E-value=1e-32, identity=93.88% | |
| 4-104, io94b12.b1 Brain - Cerebellum Library (DOGEST8) Canis familiaris (gb|CN000134.1|), blast E-value=6e-32, identity=93.07% | |
| 7-104, 1161730 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DN280603.1|), blast E-value=1e-32, identity=93.88% | |
| 7-104, LB02823.CR_E14 GC_BGC-28 Bos taurus cDNA clone IMAGE (gb|DV912187.1|), blast E-value=1e-32, identity=93.88% | |
| 7-104, 1605606 MARC 11BOV Bos taurus cDNA 5', mRNA sequence (gb|DY465185.1|), blast E-value=1e-32, identity=93.88% | |
| 19-82, 718607 MARC 6BOV Bos taurus cDNA 5', mRNA sequence (gb|CB459124.1|), blast E-value=7e-22, identity=96.88% | |
| 19-82, 959818 MARC 1BOV Bos taurus cDNA 3', mRNA sequence (gb|CK771518.1|), blast E-value=7e-22, identity=96.88% | |
| 19-82, 1161730 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DN280603.1|), blast E-value=7e-22, identity=96.88% | |
| 19-82, LB0274.CR_B17 GC_BGC-27 Bos taurus cDNA clone IMAGE (gb|DV888021.1|), blast E-value=2e-19, identity=95.31% | |
| 19-82, LB02823.CR_E14 GC_BGC-28 Bos taurus cDNA clone IMAGE (gb|DV912187.1|), blast E-value=7e-22, identity=96.88% | |
| 19-82, 1605606 MARC 11BOV Bos taurus cDNA 5', mRNA sequence (gb|DY465185.1|), blast E-value=7e-22, identity=96.88% |
| Similar Transcript(s): 12 entry(ies) | Help | Less info |
PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript
| 7-104, 718607 MARC 6BOV Bos taurus cDNA 5', mRNA sequence (gb|CB459124.1|), blast E-value=1e-32, identity=93.88% | |
| 7-104, 959818 MARC 1BOV Bos taurus cDNA 3', mRNA sequence (gb|CK771518.1|), blast E-value=1e-32, identity=93.88% | |
| 4-104, io94b12.b1 Brain - Cerebellum Library (DOGEST8) Canis familiaris (gb|CN000134.1|), blast E-value=6e-32, identity=93.07% | |
| 7-104, 1161730 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DN280603.1|), blast E-value=1e-32, identity=93.88% | |
| 7-104, LB02823.CR_E14 GC_BGC-28 Bos taurus cDNA clone IMAGE (gb|DV912187.1|), blast E-value=1e-32, identity=93.88% | |
| 7-104, 1605606 MARC 11BOV Bos taurus cDNA 5', mRNA sequence (gb|DY465185.1|), blast E-value=1e-32, identity=93.88% | |
| 19-82, 718607 MARC 6BOV Bos taurus cDNA 5', mRNA sequence (gb|CB459124.1|), blast E-value=7e-22, identity=96.88% | |
| 19-82, 959818 MARC 1BOV Bos taurus cDNA 3', mRNA sequence (gb|CK771518.1|), blast E-value=7e-22, identity=96.88% | |
| 19-82, 1161730 MARC 7BOV Bos taurus cDNA 5', mRNA sequence (gb|DN280603.1|), blast E-value=7e-22, identity=96.88% | |
| 19-82, LB0274.CR_B17 GC_BGC-27 Bos taurus cDNA clone IMAGE (gb|DV888021.1|), blast E-value=2e-19, identity=95.31% | |
| 19-82, LB02823.CR_E14 GC_BGC-28 Bos taurus cDNA clone IMAGE (gb|DV912187.1|), blast E-value=7e-22, identity=96.88% | |
| 19-82, 1605606 MARC 11BOV Bos taurus cDNA 5', mRNA sequence (gb|DY465185.1|), blast E-value=7e-22, identity=96.88% |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 3' of NM_002594, + |
| Aligned organism(s): 14 entry(ies) | More info |
| Aligned organism(s): 14 entry(ies) | Help | Less info |
| 4-164, gnl|bosTau2|chr13 (23894851-23895010) | |
| 4-164, gnl|canFam2|chr24 (8507624-8507358) | |
| 4-164, gnl|dasNov1|scaffold_22263 (8456-8191) | |
| 4-164, gnl|echTel1|scaffold_255723 (3985-4245) | |
| 4-164, gnl|hg17|chr20 (17412291-17412554) | |
| 4-164, gnl|Hg17|chr20 (17412445-17412601) | |
| 4-164, gnl|loxAfr1|scaffold_57373 (4564-4825) | |
| 4-164, gnl|mm7|chr2 (143556218-143556484) | |
| 4-164, gnl|Mm7|chr2 (143556376-143556525) | |
| 4-164, gnl|monDom2|scaffold_1 (51922448-51922726) | |
| 4-164, gnl|oryCun1|scaffold_179021 (46923-46663) | |
| 4-164, gnl|panTro1|chr21 (17263245-17263508) | |
| 4-164, gnl|rheMac2|chr10 (50808761-50809024) | |
| 4-164, gnl|rn3|chr3 (132163055-132163320) |
| Aligned organism(s): 14 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 4-164, gnl|bosTau2|chr13 (23894851-23895010) | |
| 4-164, gnl|canFam2|chr24 (8507624-8507358) | |
| 4-164, gnl|dasNov1|scaffold_22263 (8456-8191) | |
| 4-164, gnl|echTel1|scaffold_255723 (3985-4245) | |
| 4-164, gnl|hg17|chr20 (17412291-17412554) | |
| 4-164, gnl|Hg17|chr20 (17412445-17412601) | |
| 4-164, gnl|loxAfr1|scaffold_57373 (4564-4825) | |
| 4-164, gnl|mm7|chr2 (143556218-143556484) | |
| 4-164, gnl|Mm7|chr2 (143556376-143556525) | |
| 4-164, gnl|monDom2|scaffold_1 (51922448-51922726) | |
| 4-164, gnl|oryCun1|scaffold_179021 (46923-46663) | |
| 4-164, gnl|panTro1|chr21 (17263245-17263508) | |
| 4-164, gnl|rheMac2|chr10 (50808761-50809024) | |
| 4-164, gnl|rn3|chr3 (132163055-132163320) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| fco (0.157208) |