rpgl26_o7.y1
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
CAACAAGTCACTAGAAATGAACCCCGAAATGCAAACAGCCACCTCGATTTCCTAGGAAAT CAACTTTCTCTTTAAAATCTCCTGGAATAAGGCCTAATACAGGCCGACATGGCTCTACCT CAGGTACTTTACGAGGCCATCCAACACCATTAGAAAGAGAACCATGTAAAATAAGCTT |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
CAACAAGTCACTAGAAATGAACCCCGAAATGCAAACAGCCACCTCGATTTCCTAGGAAAT CAACTTTCTCTTTAAAATCTCCTGGAATAAGGCCTAATACAGGCCGACATGGCTCTACCT CAGGTACTTTACGAGGCCATCCAACACCATTAGAAAGAGAACCATGTAAAATAAGCTT |
Predicted RNA structure(s): 1 entry(ies) | More info |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
51-178, - strand, RNAz p=0.67239 |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
51-178, - strand, RNAz p=0.67239 |
Aligned organism(s): 3 entry(ies) | More info |
Aligned organism(s): 3 entry(ies) | Help | Less info |
51-178, gnl|bosTau2|chr10 (27527232-27527105) | |
51-178, gnl|Hg17|chr14 (49667230-49667103) | |
51-178, gnl|Mm7|chr12 (67532095-67531968) |
Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
51-178, gnl|bosTau2|chr10 (27527232-27527105) | |
51-178, gnl|Hg17|chr14 (49667230-49667103) | |
51-178, gnl|Mm7|chr12 (67532095-67531968) |
Expressed library(ies): 1 entry(ies) | More info |
Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
pgl (0.118483) |