rpigca0_014549.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| AGGCCGCTCCAGATGTTTTCAGCATTAATTGCTCAGTGGGCATAGGATAAATCCTAATAT TTGTGATCTAAATATAGTAGTTGCTTTTGGTAAAATCATGAGGGTGACAACT |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| AGGCCGCTCCAGATGTTTTCAGCATTAATTGCTCAGTGGGCATAGGATAAATCCTAATAT TTGTGATCTAAATATAGTAGTTGCTTTTGGTAAAATCATGAGGGTGACAACT |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-112, gnl|bosTau2|chr27 (26926130-26926019) | |
| 1-112, gnl|Hg17|chr3 (25448070-25448178) | |
| 1-112, gnl|Mm7|chr14 (14386596-14386485) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-112, gnl|bosTau2|chr27 (26926130-26926019) | |
| 1-112, gnl|Hg17|chr3 (25448070-25448178) | |
| 1-112, gnl|Mm7|chr14 (14386596-14386485) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| clu (0.119646) |