rpigcb_16451.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GTGATAAATGGTGTCTACACTAGCCCGCTACCCCCATGGGCACAGCAATCGACTGGTTGG GGGTTCTCAGCAGAACTCCCTTTGCATATTCGATCCCCTGGGGGCAGAGAAGGGGGTGTT GACTGGGCACTTGTTTCTTTCCCAAGGGGAGCATGGCCTGGGCCCCTACCAGCATCCTGA GGGTGAGCCCTGAAAATCCCAGGCCTGGGCGCAGGCGGGGAGAGGCCGGGCTGGCTGGC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GTGATAAATGGTGTCTACACTAGCCCGCTACCCCCATGGGCACAGCAATCGACTGGTTGG GGGTTCTCAGCAGAACTCCCTTTGCATATTCGATCCCCTGGGGGCAGAGAAGGGGGTGTT GACTGGGCACTTGTTTCTTTCCCAAGGGGAGCATGGCCTGGGCCCCTACCAGCATCCTGA GGGTGAGCCCTGAAAATCCCAGGCCTGGGCGCAGGCGGGGAGAGGCCGGGCTGGCTGGC |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 8-201, - strand, RNAz p=0.997801 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 8-201, - strand, RNAz p=0.997801 |
| Predicted microRNA(s): 1 entry(ies) | More info |
| Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 56-221, + strand, RNAmicro p=0.996534 |
| Homologous human UTR: 1 entry(ies) | More info |
| Homologous human UTR: 1 entry(ies) | Help | Less info |
Human gene identifier and UTR site,
human gene reading direction
human gene reading direction
| 3' of NM_018929, - |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 1-238, gnl|bosTau2|chr7 (35336610-35336370) | |
| 1-238, gnl|Hg17|chr5 (140871210-140870963) | |
| 1-238, gnl|Mm7|chr18 (38216650-38216374) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-238, gnl|bosTau2|chr7 (35336610-35336370) | |
| 1-238, gnl|Hg17|chr5 (140871210-140870963) | |
| 1-238, gnl|Mm7|chr18 (38216650-38216374) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| cty (0.10408) |