rpigcb_2378.y1
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
TAAAATTTAAAAAATTTTCTCTTTCACGGTCATCAGTTCTAGTCATGGATATTTGAAATT GGACAACCACAAGTCTGAGAGATTTGAAATTTCAGGCTATGTGGCAACGTCTTTGGTACA TTTGAAAGGTCTGACTAAATCAGTCTTAACTTTGGGTGGCTTGAAAATTGGGGCAAGATC ACACACTGTGTGGTTAGTGGAGACCGGCAGTGTTTGTGCATCCCTGATATCCTTTGTGTT GTAATTTATCACCCTTTTGTGTTTCACAGATCTGGCTTTGATTGGCTGATGAGTGTCTTT GTGATCAGTTAAAAGTGGTAGAATGTATGTACGTGG |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
TAAAATTTAAAAAATTTTCTCTTTCACGGTCATCAGTTCTAGTCATGGATATTTGAAATT GGACAACCACAAGTCTGAGAGATTTGAAATTTCAGGCTATGTGGCAACGTCTTTGGTACA TTTGAAAGGTCTGACTAAATCAGTCTTAACTTTGGGTGGCTTGAAAATTGGGGCAAGATC ACACACTGTGTGGTTAGTGGAGACCGGCAGTGTTTGTGCATCCCTGATATCCTTTGTGTT GTAATTTATCACCCTTTTGTGTTTCACAGATCTGGCTTTGATTGGCTGATGAGTGTCTTT GTGATCAGTTAAAAGTGGTAGAATGTATGTACGTGG |
Predicted RNA structure(s): 1 entry(ies) | More info |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
40-159, + strand, RNAz p=0.740145 |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
40-159, + strand, RNAz p=0.740145 |
Predicted microRNA(s): 1 entry(ies) | More info |
Predicted microRNA(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
40-137, + strand, RNAmicro p=0.958072 |
Aligned organism(s): 3 entry(ies) | More info |
Aligned organism(s): 3 entry(ies) | Help | Less info |
1-336, gnl|bosTau2|chr28 (16603719-16603383) | |
1-336, gnl|Hg17|chr10 (70186585-70186915) | |
1-336, gnl|Mm7|chr10 (62282779-62282454) |
Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
1-336, gnl|bosTau2|chr28 (16603719-16603383) | |
1-336, gnl|Hg17|chr10 (70186585-70186915) | |
1-336, gnl|Mm7|chr10 (62282779-62282454) |
Expressed library(ies): 1 entry(ies) | More info |
Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
cty (0.10408) |