rpigcb_3163.y1
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
CTAGCTTCCTCTTTGACCATTGGGATCAGGTTTTGGAGCCCATCCAGAGAAGCCATGTGA AAGGAAGGGCAGAACTCTAATGCAGTTGCTAGTGCCTAGAGATAGGGGCTGTTTCTTTTT ATTCAGTACTATGACAGTACTGAATAAATTTTCATCTTAGGAGACAAAGGTACATGCAAA GAGTGGACCCTAATCTTTAC |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
CTAGCTTCCTCTTTGACCATTGGGATCAGGTTTTGGAGCCCATCCAGAGAAGCCATGTGA AAGGAAGGGCAGAACTCTAATGCAGTTGCTAGTGCCTAGAGATAGGGGCTGTTTCTTTTT ATTCAGTACTATGACAGTACTGAATAAATTTTCATCTTAGGAGACAAAGGTACATGCAAA GAGTGGACCCTAATCTTTAC |
Predicted RNA structure(s): 1 entry(ies) | More info |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
81-200, + strand, RNAz p=0.994302 |
Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
81-200, + strand, RNAz p=0.994302 |
Aligned organism(s): 2 entry(ies) | More info |
Aligned organism(s): 2 entry(ies) | Help | Less info |
2-200, gnl|bosTau2|chr23 (17194013-17193817) | |
2-200, gnl|Hg17|chr6 (43410344-43410150) |
Aligned organism(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
2-200, gnl|bosTau2|chr23 (17194013-17193817) | |
2-200, gnl|Hg17|chr6 (43410344-43410150) |
Expressed library(ies): 1 entry(ies) | More info |
Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
cty (0.10408) |