rpigcb_9729.y1
| Sequence: | Distiller database | More info | 
| Sequence: | Distiller database | Help | Less info | 
| ATAAAACATCAAAGAATCCACACTGGCGAGAAACCATATAAATGTGATGTGTGTGGGAAA GCCTTCAGTCAGAGCTCAGATCTTATTCTGCATCAGAGAATTCACA | 
| Sequence: | Distiller database | Help | Less info | 
Blue-coloured subsequences are predicted RNA structures by RNAz
| ATAAAACATCAAAGAATCCACACTGGCGAGAAACCATATAAATGTGATGTGTGTGGGAAA GCCTTCAGTCAGAGCTCAGATCTTATTCTGCATCAGAGAATTCACA | 
| Aligned organism(s): 2 entry(ies) | More info | 
| Aligned organism(s): 2 entry(ies) | Help | Less info | 
| 1-106, gnl|bosTau2|chr24 (17036153-17036048) | |
| 1-106, gnl|Mm7|chr18 (24387951-24388056) | 
| Aligned organism(s): 2 entry(ies) | Help | Less info | 
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 1-106, gnl|bosTau2|chr24 (17036153-17036048) | |
| 1-106, gnl|Mm7|chr18 (24387951-24388056) | 
| Expressed library(ies): 1 entry(ies) | More info | 
| Expressed library(ies): 1 entry(ies) | Help | Less info | 
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| cty (0.10408) | 
