rpigcf0_002880.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| CAACACCATCAGCATACGGAAGAGCTGGACTAGAAAGGATCCCTAAGGTCCCTTCCAACT CTGACGTTGTAGGATTCTATGAATAGGGTTAAAGAGATCTGGGACCAGCGATTGCTTCCC CACCCTAGCAACTGTTGCTAGACGAGGGCCATCTCCTGGTACAAGTGGAAACTCCTCCCT GCATCGGGGAGGTCTTTTAGCATCCCATCAGGCATCGCGACTTCGCCTCTCTAGGAAGCA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| CAACACCATCAGCATACGGAAGAGCTGGACTAGAAAGGATCCCTAAGGTCCCTTCCAACT CTGACGTTGTAGGATTCTATGAATAGGGTTAAAGAGATCTGGGACCAGCGATTGCTTCCC CACCCTAGCAACTGTTGCTAGACGAGGGCCATCTCCTGGTACAAGTGGAAACTCCTCCCT GCATCGGGGAGGTCTTTTAGCATCCCATCAGGCATCGCGACTTCGCCTCTCTAGGAAGCA |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 124-240, + strand, RNAz p=0.775304 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 124-240, + strand, RNAz p=0.775304 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 6-240, gnl|bosTau2|chr16 (38764079-38764313) | |
| 6-240, gnl|Hg17|chr1 (15598203-15598437) | |
| 6-240, gnl|Mm7|chr4 (141169572-141169344) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 6-240, gnl|bosTau2|chr16 (38764079-38764313) | |
| 6-240, gnl|Hg17|chr1 (15598203-15598437) | |
| 6-240, gnl|Mm7|chr4 (141169572-141169344) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| ctl (0.153069) |