rthg11_i17.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GAATTTTATCATCATGAAATTTATAAACCAAGAAGGGAACAAATATTTACACTTGCAACT TCATGTCAACATTGCCCACTATTTGAAGAGCTCTGAAAATGTAAATCTATCTCCCA |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GAATTTTATCATCATGAAATTTATAAACCAAGAAGGGAACAAATATTTACACTTGCAACT TCATGTCAACATTGCCCACTATTTGAAGAGCTCTGAAAATGTAAATCTATCTCCCA |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 4-116, gnl|bosTau2|chr28 (24232015-24231903) | |
| 4-116, gnl|Hg17|chr10 (76305854-76305966) | |
| 4-116, gnl|Mm7|chr14 (19199806-19199920) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 4-116, gnl|bosTau2|chr28 (24232015-24231903) | |
| 4-116, gnl|Hg17|chr10 (76305854-76305966) | |
| 4-116, gnl|Mm7|chr14 (19199806-19199920) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| thg (0.126791) |