rtra13_j5r1.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| AGAACAAGAATTTGAAACCAGTTTGCATGCCTCTATAGCCAGCACTCTCTCTCCTCTACC ACTTCACCTGTCAACAGTCATTTCACCTGTGTCATAGAGCTTTGATCAtcacatttgtat ggaaacacaaaagacttcaaatagccaaagcagtattgaaaagaaaaaaatggaaccgga gaaatcaggctccctgacttcagactctactacaaagctacagtcatcaaaacagtatgg tactggcacaaaGAAATCAATGGAACAGGATAGAAAGCCCAGAAATAAC |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| AGAACAAGAATTTGAAACCAGTTTGCATGCCTCTATAGCCAGCACTCTCTCTCCTCTACC ACTTCACCTGTCAACAGTCATTTCACCTGTGTCATAGAGCTTTGATCAtcacatttgtat ggaaacacaaaagacttcaaatagccaaagcagtattgaaaagaaaaaaatggaaccgga gaaatcaggctccctgacttcagactctactacaaagctacagtcatcaaaacagtatgg tactggcacaaaGAAATCAATGGAACAGGATAGAAAGCCCAGAAATAAC |
| Aligned organism(s): 1 entry(ies) | More info |
| Aligned organism(s): 1 entry(ies) | Help | Less info |
| 113-288, gnl|bosTau2|chr12 (25266515-25266331) |
| Aligned organism(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 113-288, gnl|bosTau2|chr12 (25266515-25266331) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| tra (0.123092) |