rute2102b_o20.y1
Sequence: | Distiller database | More info |
Sequence: | Distiller database | Help | Less info |
TGTCCTTCTGACTGACTTTGCTTGATAATCTCTAGTGTCCATCCATGTTGCTGCAATATG GCATTATTTCGTTTTCTTTGATGGCCCAGTAATATCACACACACACACACACACACACAC gtatatatacaatgtcttctttatccatttgtctgatgatggactcttaagttgctccct tgtcttggctgttgtgaatagtgctgctgtgaacatgggggtgcatgtatcttttcgaat ttacacttttgtttggatagatgcccaagagtgggattgctggatcatatgg |
Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
TGTCCTTCTGACTGACTTTGCTTGATAATCTCTAGTGTCCATCCATGTTGCTGCAATATG GCATTATTTCGTTTTCTTTGATGGCCCAGTAATATCACACACACACACACACACACACAC gtatatatacaatgtcttctttatccatttgtctgatgatggactcttaagttgctccct tgtcttggctgttgtgaatagtgctgctgtgaacatgggggtgcatgtatcttttcgaat ttacacttttgtttggatagatgcccaagagtgggattgctggatcatatgg |
Aligned organism(s): 1 entry(ies) | More info |
Aligned organism(s): 1 entry(ies) | Help | Less info |
7-292, gnl|bosTau2|chr22 (38313627-38313915) |
Aligned organism(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
7-292, gnl|bosTau2|chr22 (38313627-38313915) |
Expressed library(ies): 1 entry(ies) | More info |
Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
ute (0.132784) |