rute2104b_p22.y1
| Sequence: | Distiller database | More info |
| Sequence: | Distiller database | Help | Less info |
| GCAGAGATGCTGCTTCCCGCCAAAGACTGTGAATTTTAAGCCTGACTCAGTGGACTCTTT CCTGTTCCCTTTCTCTCCTCTTCCTCAGCCCATCCTGCCCCAGAGCCCCTCTCCAAGGCC TCGCAGCAGGATTCCGGGGCCTTCTCGCTGGGACACCCTGGCCCAGCTCGGAGGCCTCGT TGGGACTGAGCAAGGCCCGACCTCCAGGCCAAATTTGCTTCCATAGCT |
| Sequence: | Distiller database | Help | Less info |
Blue-coloured subsequences are predicted RNA structures by RNAz
| GCAGAGATGCTGCTTCCCGCCAAAGACTGTGAATTTTAAGCCTGACTCAGTGGACTCTTT CCTGTTCCCTTTCTCTCCTCTTCCTCAGCCCATCCTGCCCCAGAGCCCCTCTCCAAGGCC TCGCAGCAGGATTCCGGGGCCTTCTCGCTGGGACACCCTGGCCCAGCTCGGAGGCCTCGT TGGGACTGAGCAAGGCCCGACCTCCAGGCCAAATTTGCTTCCATAGCT |
| Predicted RNA structure(s): 1 entry(ies) | More info |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
| 47-227, - strand, RNAz p=0.997086 |
| Predicted RNA structure(s): 1 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz
| 47-227, - strand, RNAz p=0.997086 |
| Predicted microRNA(s): 2 entry(ies) | More info |
| Predicted microRNA(s): 2 entry(ies) | Help | Less info |
| 88-226, - strand, RNAmicro p=0.999994 | |
| 114-186, + strand, RNAmicro p=0.999973 |
| Predicted microRNA(s): 2 entry(ies) | Help | Less info |
PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro
| 88-226, - strand, RNAmicro p=0.999994 | |
| 114-186, + strand, RNAmicro p=0.999973 |
| Aligned organism(s): 3 entry(ies) | More info |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
| 8-227, gnl|bosTau2|chr10 (30634665-30634450) | |
| 8-227, gnl|Hg17|chr15 (62820161-62819942) | |
| 8-227, gnl|Mm7|chr9 (65689164-65689342) |
| Aligned organism(s): 3 entry(ies) | Help | Less info |
PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map
| 8-227, gnl|bosTau2|chr10 (30634665-30634450) | |
| 8-227, gnl|Hg17|chr15 (62820161-62819942) | |
| 8-227, gnl|Mm7|chr9 (65689164-65689342) |
| Expressed library(ies): 1 entry(ies) | More info |
| Expressed library(ies): 1 entry(ies) | Help | Less info |
Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description
| ute (0.132784) |