Non-Coding RNA Search

rute2108b_o5.y1

Sequence:


               
               CGGAGGCACCTCTCCTGAGTCTTAGGCTGCGGAGTCTAAGACTGAGAGAGAGGAGCCCCG
GAGGAGACTGACTTTTTCTTCCCTTCTCCCATCCCTCCTTTTTGCTCAGAGGCCAGCAGA
GGCGCGGAGCTTTAGAAAGTTGAGAGGTTAGGAAGGTAGGGGCTTCCTTTTTTTCTCCTC
CCGCCGAGGTGGGGCTGGGACCTCCGGACCCGGCTTCTTACCTCGCAAGGAGCACCTTTG
TCGGCTCCAGCAGCCGACGCGCTTCGGAGCTGCTCTCTGCAGAGCCAGAGGGTGGGTCGG
CTTCGCCGTGTGTGCGTGAGAATGGATCGCAGGTCCCGAGCTCAGCA

Sequence:

Distiller database | Help | Less info

Blue-coloured subsequences are predicted RNA structures by RNAz


               
               CGGAGGCACCTCTCCTGAGTCTTAGGCTGCGGAGTCTAAGACTGAGAGAGAGGAGCCCCG
GAGGAGACTGACTTTTTCTTCCCTTCTCCCATCCCTCCTTTTTGCTCAGAGGCCAGCAGA
GGCGCGGAGCTTTAGAAAGTTGAGAGGTTAGGAAGGTAGGGGCTTCCTTTTTTTCTCCTC
CCGCCGAGGTGGGGCTGGGACCTCCGGACCCGGCTTCTTACCTCGCAAGGAGCACCTTTG
TCGGCTCCAGCAGCCGACGCGCTTCGGAGCTGCTCTCTGCAGAGCCAGAGGGTGGGTCGG
CTTCGCCGTGTGTGCGTGAGAATGGATCGCAGGTCCCGAGCTCAGCA

Predicted RNA structure(s): 2 entry(ies)

More info

Predicted RNA structure(s): 2 entry(ies)

Help | Less info


               
               1-273, - strand, RNAz p=0.999908
               

               
               10-265, - strand, RNAz p=0.995562

Predicted RNA structure(s): 2 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted RNA structure by RNAz,
PigEST conread reading direction of predicted structure,
ncRNA classificator p of RNAz


               
               1-273, - strand, RNAz p=0.999908
               

               
               10-265, - strand, RNAz p=0.995562

Predicted microRNA(s): 2 entry(ies)

More info

Predicted microRNA(s): 2 entry(ies)

Help | Less info


               
               1-60, + strand, RNAmicro p=0.924791
               

               
               182-273, + strand, RNAmicro p=0.912288

Predicted microRNA(s): 2 entry(ies)

Help | Less info

PigEST conread start position and end position of the predicted microRNA,
PigEST conread reading direction of prediction,
miRNA classificator p of RNAmicro


               
               1-60, + strand, RNAmicro p=0.924791
               

               
               182-273, + strand, RNAmicro p=0.912288

Similar Transcript(s): 6 entry(ies)

More info

Similar Transcript(s): 6 entry(ies)

Help | Less info


               
               1-273, LB03035.CR_G24 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE372859.1|), 
blast E-value=0, identity=85.82% 
               

               
               1-273, LB03037.CR_H01 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE376659.1|), 
blast E-value=0, identity=85.82% 
               

               
               1-273, LB03068.CR_K04 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE382219.1|), 
blast E-value=0, identity=85.82% 
               

               
               1-273, LB03088.CR_F18 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE387953.1|), 
blast E-value=0, identity=85.82% 
               

               
               1-273, LB03093.CR_O22 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE389615.1|), 
blast E-value=0, identity=85.82% 
               

               
               1-273, LB030104.CR_L15 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE390741.1|), 
blast E-value=0, identity=85.82%

Similar Transcript(s): 6 entry(ies)

Help | Less info

PigEST conread start position and end position of sequence similarity to another annotated EST (NCBI dbEST),
transcript identifier and annotation,
blast E-value,
PigEST conread identity to the similar transcript


               
               1-273, LB03035.CR_G24 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE372859.1|), 
blast E-value=0, identity=85.82% 
               

               
               1-273, LB03037.CR_H01 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE376659.1|), 
blast E-value=0, identity=85.82% 
               

               
               1-273, LB03068.CR_K04 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE382219.1|), 
blast E-value=0, identity=85.82% 
               

               
               1-273, LB03088.CR_F18 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE387953.1|), 
blast E-value=0, identity=85.82% 
               

               
               1-273, LB03093.CR_O22 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE389615.1|), 
blast E-value=0, identity=85.82% 
               

               
               1-273, LB030104.CR_L15 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb|EE390741.1|), 
blast E-value=0, identity=85.82%

Aligned organism(s): 13 entry(ies)

More info

Aligned organism(s): 13 entry(ies)

Help | Less info


               
               1-346, gnl|bosTau2|chr13 (37925535-37925189)
               

               
               1-346, gnl|canFam2|chr24 (46569993-46570652)
               

               
               1-346, gnl|dasNov1|scaffold_4717 (55102-54500)
               

               
               1-346, gnl|echTel1|scaffold_323982 (75128-75783)
               

               
               1-346, gnl|hg17|chr20 (56847815-56848464)
               

               
               1-346, gnl|Hg17|chr20 (56848233-56848581)
               

               
               1-346, gnl|loxAfr1|scaffold_75847 (6758-7402)
               

               
               1-346, gnl|mm7|chr2 (174028330-174028975)
               

               
               1-346, gnl|Mm7|chr2 (174028749-174029092)
               

               
               1-346, gnl|oryCun1|scaffold_173739 (40232-39604)
               

               
               1-346, gnl|panTro1|chr21 (59840351-59840990)
               

               
               1-346, gnl|rheMac2|chr10 (5691587-5690939)
               

               
               1-346, gnl|rn3|chr3 (165119035-165119682)

Aligned organism(s): 13 entry(ies)

Help | Less info

PigEST conread start position and end position of the aligned locus,
aligned organism with chromosome (chromosome position)
closely related Artiodactyla cow is linked to the PigEST - Genome Map


               
               1-346, gnl|bosTau2|chr13 (37925535-37925189)
               

               
               1-346, gnl|canFam2|chr24 (46569993-46570652)
               

               
               1-346, gnl|dasNov1|scaffold_4717 (55102-54500)
               

               
               1-346, gnl|echTel1|scaffold_323982 (75128-75783)
               

               
               1-346, gnl|hg17|chr20 (56847815-56848464)
               

               
               1-346, gnl|Hg17|chr20 (56848233-56848581)
               

               
               1-346, gnl|loxAfr1|scaffold_75847 (6758-7402)
               

               
               1-346, gnl|mm7|chr2 (174028330-174028975)
               

               
               1-346, gnl|Mm7|chr2 (174028749-174029092)
               

               
               1-346, gnl|oryCun1|scaffold_173739 (40232-39604)
               

               
               1-346, gnl|panTro1|chr21 (59840351-59840990)
               

               
               1-346, gnl|rheMac2|chr10 (5691587-5690939)
               

               
               1-346, gnl|rn3|chr3 (165119035-165119682)

Expressed library(ies): 1 entry(ies)

More info

Expressed library(ies): 1 entry(ies)

Help | Less info


               
               ute (0.132784)

Expressed library(ies): 1 entry(ies)

Help | Less info

Short name of the library (expression score),
see https://rth.dk/resources/pigest/download/pigest_kvl_1.0.1/cDNA_names.html for library description


               
               ute (0.132784)

	1-273, - strand, RNAz p=0.999908
	10-265, - strand, RNAz p=0.995562

	1-60, + strand, RNAmicro p=0.924791
	182-273, + strand, RNAmicro p=0.912288

	1-273, LB03035.CR_G24 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb\|EE372859.1\|), blast E-value=0, identity=85.82%
	1-273, LB03037.CR_H01 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb\|EE376659.1\|), blast E-value=0, identity=85.82%
	1-273, LB03068.CR_K04 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb\|EE382219.1\|), blast E-value=0, identity=85.82%
	1-273, LB03088.CR_F18 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb\|EE387953.1\|), blast E-value=0, identity=85.82%
	1-273, LB03093.CR_O22 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb\|EE389615.1\|), blast E-value=0, identity=85.82%
	1-273, LB030104.CR_L15 GC_BGC-30 Bos taurus cDNA clone IMAGE (gb\|EE390741.1\|), blast E-value=0, identity=85.82%

	1-346, gnl\|bosTau2\|chr13 (37925535-37925189)
	1-346, gnl\|canFam2\|chr24 (46569993-46570652)
	1-346, gnl\|dasNov1\|scaffold_4717 (55102-54500)
	1-346, gnl\|echTel1\|scaffold_323982 (75128-75783)
	1-346, gnl\|hg17\|chr20 (56847815-56848464)
	1-346, gnl\|Hg17\|chr20 (56848233-56848581)
	1-346, gnl\|loxAfr1\|scaffold_75847 (6758-7402)
	1-346, gnl\|mm7\|chr2 (174028330-174028975)
	1-346, gnl\|Mm7\|chr2 (174028749-174029092)
	1-346, gnl\|oryCun1\|scaffold_173739 (40232-39604)
	1-346, gnl\|panTro1\|chr21 (59840351-59840990)
	1-346, gnl\|rheMac2\|chr10 (5691587-5690939)
	1-346, gnl\|rn3\|chr3 (165119035-165119682)